BSU24870

BSU_24870

1521

1524

cell division or sugar metabolism

cell division

BSU24870

BSU_24870

2,571,907 → 2,573,430

2,571,907 2,573,430

Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to Swiss-Prot)

Cleaves type-1 transmembrane domains using a catalytic dyad composed of serine and histidine that are contributed by different transmembrane domains (according to UniProt)

cleavage of [[protein|MgtE]] between its first and second trans-membrane helix at low magnesium concentration or high manganese or zinc concentrations to prevent uptake of toxic metal ions [pubmed|31930742]

acts as adapter protein for [[protein|FtsH]] [pubmed|31930742]

peptidase S54 family (according to Swiss-Prot)

[SW|peptidase S54 family] (according to UniProt)

MGNA-C445 (yqgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2443 NBRP B. subtilis, Japan]

MGNA-C445 (yqgP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2443 NBRP B. subtilis, Japan]

BKE24870 ([[gene|yqgP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG

BKK24870 ([[gene|yqgP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTACCGCTCCAATAG, downstream forward: _UP4_TAGAGGTGGAATATGGAAAG

23518036

19421188, 23518036

19421188, 15050034, 22921757

15050034, 22921757, 15616571, 31930742

[[this]]

two [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)

Mn²⁺ and Zn²⁺ bind to the N-terminal cytosolic domain of YqgE to stimulate [[protein|MgtE]] degradation [pubmed|31930742]